In continuing the scenario from Assignment 1, the president at Ocper, Inc. has accepted your proposal and has indicated that she would like to make additional changes to the network. She would like to add four servers to the network so employees can share files. She would also like to allow VPN access for her employees so they can work remotely. The president would like to complete these objectives while keeping the up-front costs to a minimum.Write 2-3 page paper in which you:1.Explain what network operating system you would suggest.2.Describe how you would incorporate the new servers into the environment proposed in Assignment 1 and how you would address what additional changes might be needed.3.Determine the best option for VPN access for the employees to remotely access the Ocper, Inc. network and explain your reasoning.

Transcription/Translation: Consider the gene below:

3′ 123456789101112131415161718192021 5′

TACCCTTAACCAATGAGTATT

5′

ATGGGAATTGGTTACTCATAA 3′

1.In the space below, write the nucleotide sequence for the mRNA encoded by the gene. Be sure to indicate the 3′ and 5′ ends for the mRNA.

2.Circle the translation start codon in the mRNA above.

3.What is the nucleotide sequence in the anti-codon loop of tRNA that is complementary to the start codon? ______. Indicate the 3′ and 5′ side of the anti-codon region.

4.What amino acid does the start codon specify? ________

5.Circle the translation stop codon in the mRNA strand above.

6.Using a codon table (see table in your text), in the space below write the predicted sequence of amino acids for the polypeptide encoded by this gene.