The Case of the Oily Rags

Outside of the city’s Fleet Operations maintenance bays, there is a dumpster with a nicely painted sign stating “Deposit Oily Rags Here.” As the newly appointed EH&S manager for the city, you ask the next pressing question to the maintenance supervisor, “After you put your oily rags in the dumpster, where does the dumpster go?” His response was, “they take them out to the power plant and burn them.” Two days later, while you are out at the power plant, you ask the operations manager about the burning of oily rags in the unit. He tells you that they used to do that, but now, with the newer changes in place from the EPA, they are not allowed to. So, you ask yet another obvious question, “Then why are these dumpsters of oily rags coming out here?” He was surprised that you mentioned it because he had been wondering that himself. Now he has four dumpsters on his property filled with oily rags.

• Should the oily rags stay on the power plant site?
• What responsibility does Fleet Operations have?
• How might this situation be different if the former city EH&S manager had collaborated with other city managers and employees?
• Identify the specific section of RCRA that applies to this scenario.
• Identify health and safety concerns that might occur if the oily rags were loaded into the incinerator.

 Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells

 Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 

Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

• aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

• aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc